Metadata-Version: 1.1
Name: pydna
Version: 0.9.1
Summary: Contains classes and code for representing double
                     stranded DNA and functions for simulating homologous
                     recombination between DNA molecules.
Home-page: http://pypi.python.org/pypi/pydna/
Author: Björn Johansson
Author-email: bjorn_johansson@bio.uminho.pt
License: LICENSE.txt
Description: =====
        pydna
        =====
        
        .. image:: https://travis-ci.org/BjornFJohansson/pydna.svg 
            :target: https://travis-ci.org/BjornFJohansson/pydna
        
        .. image:: https://coveralls.io/repos/BjornFJohansson/pydna/badge.svg?branch=master  
            :target: https://coveralls.io/r/BjornFJohansson/pydna?branch=master 
          
        .. image:: https://readthedocs.org/projects/pydna/badge/?version=latest
            :target: https://readthedocs.org/projects/pydna/?badge=latest
            :alt: Documentation Status
        
        .. image:: https://img.shields.io/pypi/v/pydna.png
            :target: https://pypi.python.org/pypi//pydna/
            :alt: Downloads
            
        .. image:: https://img.shields.io/pypi/dm/pydna.png
            :target: https://pypi.python.org/pypi/pydna/
            :alt: Latest Version
        
        .. image:: https://www.versioneye.com/user/projects/553174c010e714f9e50010bb/badge.svg?style=flat(Dependency Status)!
            :target: https://www.versioneye.com/user/projects/553174c010e714f9e50010bb
            :alt: versioneye
        
        Pydna provide functions for molecular biology using python.
        Double stranded DNA sequence classes that make cut and paste
        cloning and PCR very simple is provided (see example below). 
        `Publication <http://www.biomedcentral.com/1471-2105/16/142/abstract>`_ describing pydna.
        
        ::
        
            >>> import pydna
            >>> seq = pydna.Dseq("GGATCCAAA","TTTGGATCC",ovhg=0)
            >>> seq
            Dseq(-9)
            GGATCCAAA
            CCTAGGTTT
            >>> from Bio.Restriction import BamHI
            >>> a,b = seq.cut(BamHI)
            >>> a
            Dseq(-5)
            G
            CCTAG
            >>> b
            Dseq(-8)
            GATCCAAA
                GTTT
            >>> a+b
            Dseq(-9)
            GGATCCAAA
            CCTAGGTTT
            >>> b+a
            Dseq(-13)
            GATCCAAAG
                GTTTCCTAG
            >>> b+a+b
            Dseq(-17)
            GATCCAAAGGATCCAAA
                GTTTCCTAGGTTT
            >>> b+a+a
            Traceback (most recent call last):
              File "<stdin>", line 1, in <module>
              File "/usr/local/lib/python2.7/dist-packages/pydna/dsdna.py", line 217, in __add__
                raise TypeError("sticky ends not compatible!")
            TypeError: sticky ends not compatible!
            >>>
        
        Notably, homologous recombination and Gibson assembly between linear
        DNA fragments can be easily simulated.
        
        Most functionality is implemented as methods for the double stranded
        DNA sequence record classes Dseq and Dseqrecord, which are subclasses
        of the `Biopython <http://biopython.org/wiki/Main_Page>`_
        `Seq <http://biopython.org/wiki/Seq>`_
        and
        `SeqRecord <http://biopython.org/wiki/SeqRecord>`_ classes.
        
        Pydna was designed to provide a form of executable documentation
        describing a subcloning or DNA assembly experiment. The pydna code
        unambiguously describe a sub cloning experiment, and can be executed
        to yield the sequence of the of the resulting DNA molecule.
        
        Pydna was designed to semantically imitate how sub cloning experiments are
        typically documented in Scientific literature. Pydna code describing a
        sub cloning is reasonably compact and meant to be easily readable.
        
        The nine lines of Python below, simulates the construction of a recombinant
        plasmid. DNA sequences are downloaded from Genbank by accession numbers that
        are guaranteed to be stable.
        
        ::
        
            import pydna
        
            gb = pydna.Genbank("myself@email.com") # Tell Genbank who you are!
        
            gene = gb.nucleotide("X06997") # Kluyveromyces lactis LAC12 gene for lactose permease.
        
            primer_f,primer_r = pydna.parse(''' >760_KlLAC12_rv (20-mer)
                                                ttaaacagattctgcctctg
        
                                                >759_KlLAC12_fw (19-mer)
                                                aaatggcagatcattcgag
                                                ''', ds=False)
        
            pcr_prod = pydna.pcr(primer_f,primer_r, gene)
        
            vector = gb.nucleotide("AJ001614") # pCAPs cloning vector
        
            from Bio.Restriction import EcoRV
        
            lin_vector = vector.linearize(EcoRV)
        
            rec_vec =  ( lin_vector + pcr_prod ).looped()
        
        
        Pydna might also be useful to automate the simulation of
        `sub cloning <http://en.wikipedia.org/wiki/Subcloning>`_ experiments using
        python. This could be helpful to generate examples for teaching purposes. Read
        the `documentation <https://pydna.readthedocs.org/en/latest/>`_ or the
        `cookbook <https://www.dropbox.com/sh/4re9a0wk03m95z4/AABpu4zwq4IuKUvK0Iy9Io0Fa?dl=0>`_ with example files
        for further information.
        
        An `on-line <http://pydna-shell.appspot.com/>`_ shell running Python with
        pydna is available for experimentation.
        
        Please post a message in the `google group <https://groups.google.com/d/forum/pydna>`_
        for pydna if you have problems, questions or comments.
        
        Feedback in the form of questions, comments or criticism is very welcome!
        
        =======   ========== =====================================================================
        version   date       comment
        =======   ========== =====================================================================
        0.9.1     2015-05-26 fixed critical error in the calculation of seguid and cseguid 
                             checksums
        
        0.9.0     2015-05-26 seguid and cseguid are now url safe so they can be part of urls and
                             file names.
                             Dseqrecord.locus is an alias of Dseqrecord.name
                             Dseqrecord.accession is an alias of Dseqrecord.id
                             Dseqrecord.definition is an alias of Dseqrecord.description					 
                             changed how circular assembly products are identified to use cseguid.
                             removed proxy handling when proxy not set in download module.
                             added CHANGELOG.md, currently empty.
                             environment variable datadir is now pydna_data_dir.
                             removed environmental variable pydna_dna_dir.
                             if Dseqrecord is initiated with a name property that is longer than 
                             16 characters, it is truncated to 16 chars and a warning is issued. 
                             Default Dseqrecord name property is "na".
                             Default Dseqrecord id property is "-".
                             Default Dseqrecord description property is "@".
                             Dseqrecord __eq__ and __ne__ methods defined.
                             Dseqrecord.write now overwrites an old sequence with the same 
                             filename if the primary sequence is the same.
                             Dseqrecord.read now only looks in current working directory.
                             fixed ipynb_import test code.
                            
        0.8.4     2015-04-17 Bugfix for parsing text files with unicode characters.
        
        0.8.3     ?          ?   
        
        0.8.2     ?          ?
        
        0.8.1     2015-03-07 Bugfix for windows. The data directory was not created.
        
        0.8.0	  2015-02-06 Mapping reads added.
        
        0.7.2	  2014-11-21 First public release with the changes from 0.7.0 and 0.7.1.
        					 Added a Pretty_str class to beautify output of strings in
        					 the IPython shell. 
        
        0.7.1     not public Short linkers can be incorporated in PCR primers in the 
                             assembly_primers function.
        
        0.7.0     not public Caching to speed up Amplify, Assembly, download and the 
                             Desqrecord synced method. The data is stored in four shelf
                             files in the users application directory.
                             
                             amplify.shelf
                             assembly.shelf
                             genbank.shelf
                             synced.shelf                     
                             
                             The location is os specific.
                             See the documentation of appdirs 
                             https://pypi.python.org/pypi/appdirs/1.4.0
        
        0.6.6                new function nopcr.
        
        0.6.5     2014-07-31 bugfix: cutting an amplicon object now preserves features 
                             Changed requirement for NetworkX to 1.8.1
        
        0.6.4     2014-07-09 The pcr function and Anneal class can now deal with primers 
                             with ambiguous codons like R = A or G. In the resulting PCR
                             product, the ambiguous nucleotides are preserved in the tails
                             i.e. the primer part not annealing. The annealing part will 
                             have the sequence corresponding to the template.  
        
        0.6.3     2014-07-06 Dseqrecord.add_feature can now take a string or some other
                             sequence as input. The assembly primers function can now produce 
                             primers for a circular assembly.
        
        0.6.2     2014-06-13 Dseqrecord gained three new methods:
        
                             isorf() method returning True or False.
        
                             List_features() method returns a list of all features as a
                             formatted ASCII table.
        
                             Extract_feature() extracts a feature in the form os a new
                             Dseqrecord object.
        
                             Changes to how the primer_design functions work, especially
                             assembly primers.
        
        0.6.1     2014-04-25 Fixed a bug in the Dseqrecord synced method and removed the
                             utils synced function.
        
        0.6.0     2014-04-18 Bugfixes and improvements in documentation.
        
        0.5.0     2013-12-16 Changes to how the amplify and assembly modules work
                             the Amplicon and Assembly classes are now subclasses of
                             Dseqrecord.
        
        0.2.2     2013-11-05 bugfix: changed the handling of compound features
                             to fit with the new version of BioPython (1.62) which is
                             now a requirement.
        
        0.2.1     2013-08-18 ---
        
        0.1.8     2013-06-02 bugfix: changed the SeqFeatures added to PCR products in the
                             amplify module to a dict of list of strings instead of
                             a dict of strings.
        
        0.1.7     2013-05-29 Changed the code in amplify.Amplicon to handle features
                             spanning the origin of circular sequences.
        
        0.1.6     2013-04-22 Changed the behaviour of the find method of the Dseq object
                             to find substrings that span the origin. Slicing for circular
                             Dseq objects now works slightly different.
        
        0.1.5     2013-04-18 Changed the setup.py script to permit installation
                             of the source installer without access to a c compiler.
        
        0.1.4     2013-04-10 Cleaned up some docstrings
                             Renamed Drecord -> Dseqrecord to be more consistent with
                             Dseq and Biopython Seq/SeqRecord.
        
                             Changed name of keyword argument for read and parse.
                             ds=True returns Dseqrecord(s) while ds=False returns
                             SeqRecords.
        
        0.1.3     2013-04-09 pydna created from Python-dna.
        =======   ========== =====================================================================
        
        System Requirements
        ===================
        
        - `Python 2.7 <http://www.python.org>`_.
        - `Biopython >= 1.65 <http://pypi.python.org/pypi/biopython>`_.
        - `networkx >= 1.8.1 <http://pypi.python.org/pypi/networkx>`_.
        - `appdirs >=1.3.0 <https://pypi.python.org/pypi/appdir>`_.
        - `prettytable>=0.7.2 <https://pypi.python.org/pypi/PrettyTable>`_.
        
        
        
        Python 2.x
        ----------
        
        This package was developed on and for Python 2.7. Other versions have not been tested.
        
        Python 3.x
        ----------
        
        This code has not been tried with Python 3. If there
        is sufficient interest, there might be a Python 3 version in the future.
        
        Installation
        ============
        
        PIP
        ---
        
        The best way of installing pydna is with pip. Pip is the
        officially `recommended <http://python-packaging-user-guide.readthedocs.org/en/latest/>`_ tool
        for installaion of Python packages from PyPi.
        Pip installs dependencies automatically.
        
        Linux:
        ::
        
         bjorn@bjorn-UL30A:~/Dropbox/pydna$ sudo pip install pydna
        
        Windows:
        ::
        
         C:\> pip install pydna
        
        If you do not have pip, you can get it by following
        these `instructions <http://www.pip-installer.org/en/latest/installing.html>`_.
        
        
        Source
        ------
        
        If you install from source, you need to install the dependencies (listed above).
        Download one of the source installers from the pypi site and extract the file.
        Open the pydna source code directory (containing the setup.py file) in
        terminal and type:
        
        python setup.py install
        
        Binary distribution
        -------------------
        
        There are no binary distributions available.
        
        
        Windows
        -------
        
        If dependencies have to be installed separately, this can be done using the
        binary installers for Windows for those who are not comfortable at the
        command line:
        
        ================ ========================================================
        Dependency       Hyperlink
        ================ ========================================================
        Python (32,64)   <http://www.python.org/download/>
        Biopython (32)   <http://biopython.org/wiki/Download>
        Biopython (64)   <http://www.lfd.uci.edu/~gohlke/pythonlibs/#biopython>
        networkx (32,64) <http://www.lfd.uci.edu/~gohlke/pythonlibs/#networkx>
        ================ ========================================================
        
        
        Source Code Repository
        ----------------------
        
        Pydna is hosted by [Github](https://github.com/BjornFJohansson/pydna)
        
        
        Distribution Structure
        ======================
        
        README.txt          -- This file.
        
        LICENSE.txt         -- What you can do with the code.
        
        setup.py            -- Installation file.
        
        run_tests.py        -- run tests by "python run_tests.py"<enter>
        
        pydna/              -- The code.
        
        docs/               -- Documentation and cookbook.
        
        scripts/            -- Miscellaneous and perhaps useful scripts and examples.
        
        tests/              -- Testing code.
        
        Todo
        ====
        
        * Add identification of each fragment in the Contig.small_figure method.
        
Keywords: bioinformatics
Platform: UNKNOWN
Classifier: Development Status :: 4 - Beta
Classifier: Environment :: Console
Classifier: Intended Audience :: Education
Classifier: Intended Audience :: Developers
Classifier: Intended Audience :: Science/Research
Classifier: License :: OSI Approved :: BSD License
Classifier: Programming Language :: Python :: 2.7
Classifier: Topic :: Education
Classifier: Topic :: Scientific/Engineering :: Bio-Informatics
