{ "info": { "author": "Manu S", "author_email": "manuvaivasvata7@gmail.com", "bugtrack_url": null, "classifiers": [ "Development Status :: 5 - Production/Stable", "Intended Audience :: Science/Research", "License :: OSI Approved :: MIT License", "Natural Language :: English", "Operating System :: MacOS", "Operating System :: Microsoft :: Windows", "Operating System :: POSIX :: Linux", "Operating System :: Unix", "Programming Language :: Python", "Topic :: Scientific/Engineering :: Bio-Informatics", "Topic :: Utilities" ], "description": ".. image:: https://raw.githubusercontent.com/bhagya-ct/molbery/master/molbery.png\r\n\r\nMOLecular Beacons powered by ExonucleaseIII RecYcling.\r\n~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~\r\n`Molbery`_ is a python based tool which identifies 29mer probes with 7 bases in stem, 8 in loop and 7 overhang bases from a fasta sequence. This is based on the method developed by Zuo, Xiaolei, et al. [Ref1]_ which descibes an Exo III aided target recycling method for nucleic acid signature amplification. It uses the formula suggested by Howley, Peter M., et al. [Ref2]_ for calculation of melting temperature of the probes. Other than general criteria like GC content & Tm, there are special considerations in the property of the probe sequence which are reported to be optimal. More information will be available after publication of the tool in a scientific journal.\r\n\r\nFeatures\r\n--------\r\nThe latest release includes:\r\n\r\n Support for Fasta & multi-Fasta format\r\n\r\n Manual specification of GC content, Tm range & Salt Conc.\r\n\r\n reStructuredText Output\r\n\r\n BLAST connect with parallel execution\r\n\r\n\r\nCompatibility\r\n-------------\r\n Molbery is a cross platform tool which runs on Windows, Linux and OS X with the latest & major releases of python 2 & 3.\r\n\r\nLicense\r\n-------\r\n\r\n Molbery is an open source tool available under the OSI approved MIT license.\r\n\r\n Copyright (c) 2016 Bhagya C T\r\n\r\n Copyright (c) 2016 Manu S\r\n\r\n Please read the license content `here`_.\r\n\r\nInstallation\r\n------------\r\n\r\n All the Python packages required for Molbery will be installed with `pip`_.\r\n\r\n Run cmd with Administrator permissions in Windows.\r\n ::\r\n\r\n > pip install molbery\r\n\r\n Run command with sudo permissions in Linux and OS X.\r\n ::\r\n\r\n $ sudo pip install molbery\r\n\r\n\r\n You can manually download the Molbery repository or simply clone it.\r\n\r\n ::\r\n\r\n $ git clone https://github.com/bhagya-ct/molbery\r\n\r\nUsage\r\n-----\r\n After succesful installation refer command help for all available options.\r\n ::\r\n\r\n $ molbery --help\r\n\r\n For a single FASTA input run\r\n ::\r\n\r\n $ molbery --blast --out -g -c -t -m -s \r\n\r\n For a multi-FASTA input run (Output cannot be specified for multiple seq. Default is sequence ID present in multi-FASTA)\r\n ::\r\n\r\n $ molbery --blast --multi -g -c -t -m -s \r\n\r\nSample Output\r\n-------------\r\n\r\n Sequence ID - \r\n\r\n+---------+-------------------------------+----------+----------+---------------+---------------+\r\n| Probe | Molberys (29mer Probes) | GC (%) | Tm (C) | Stem Tm (C) | Loop Tm (C) |\r\n+=========+===============================+==========+==========+===============+===============+\r\n| 1 | ACCGTAGAGCTACGACTACGGTACATTAC | 48.28 | 69.9 | 22 | 24 |\r\n+---------+-------------------------------+----------+----------+---------------+---------------+\r\n| 2 | AGTCGTATGCATACGTACGACTAAGCTAC | 44.83 | 68.9 | 20 | 24 |\r\n+---------+-------------------------------+----------+----------+---------------+---------------+\r\n| 3 | ACTTTTCGTGCTGAAGAAAAGTGAAAGCG | 41.38 | 66.9 | 18 | 24 |\r\n+---------+-------------------------------+----------+----------+---------------+---------------+\r\n| 4 | AGCTTAGACGTACGACTAAGCTACGACTA | 44.83 | 68.9 | 20 | 24 |\r\n+---------+-------------------------------+----------+----------+---------------+---------------+\r\n| 5 | AGATTCGAAGCGAACCGAATCTGCATACG | 48.28 | 69.9 | 20 | 24 |\r\n+---------+-------------------------------+----------+----------+---------------+---------------+\r\n\r\nNote: Blast Outputs are written to _blast_results/ folder with individual text file for every probe.\r\n\r\nAuthors and Contributors\r\n------------------------\r\n\r\n The tool is designed and developed by Bhagya C T, Scientist-Biotechnology, Omix Research & Diagnostics Labs and Manu S, Institute of Bioinformatics & Applied Biotechnology. The authors are grateful to Dr. Sudeshna Adak, CEO & Director, Omix Research & Diagnostics Labs for providing important technical supervision and discussions.\r\n\r\nSource code\r\n-----------\r\n\r\n The source codes of Molbery are available\r\n\r\n via git: https://github.com/bhagya-ct/molbery\r\n\r\n via Pypi: https://pypi.python.org/pypi/molbery\r\n\r\n\r\n\r\nCredits\r\n-------\r\n\r\nThanks to the Pythonistas for some wonderful plugin modules and libraries which saves a lot of Caffeine and Code!\r\n\r\n * `joblib`_\r\n * `argparse`_\r\n * `tabulate`_\r\n * `regex`_\r\n * `biopython`_\r\n\r\nFAQs\r\n----\r\n Q1) pip command not found?\r\n\r\n Ans. You probably don't have the latest release of Python. Update Python or install `pip`_.\r\n\r\n Q2) Installation was successful but could not find molbery command?\r\n\r\n Ans. You would not have given Admin or sudo permissions while installing. Run $ pip uninstall molbery and reinstall with Admin or sudo permissions.\r\n\r\nBugs\r\n----\r\n\r\nIf you find a bug in molbery (pypi), please try to reproduce it with latest python 2.7 and 3.5.\r\n\r\nIf the problem persists, please file a bug in the github issue tracking system in the repository `page`_.\r\nFor questions, troubleshooting and requests, please feel free to contact us at bhagyathimmappa@gmail.com or smanu@ibab.ac.in\r\n\r\nReferences\r\n----------\r\n.. _Molbery: https://github.com/bhagya-ct/molbery\r\n.. [Ref1] Zuo, X., Xia, F., Xiao, Y., & Plaxco, K. W. (2010). Sensitive and selective amplified fluorescence DNA detection based on exonuclease III-aided target recycling. Journal of the American Chemical Society, 132(6), 1816-1818.\r\n.. [Ref2] Howley, P. M., Israel, M. A., Law, M. F., & Martin, M. A. (1979). A rapid method for detecting and mapping homology between heterologous DNAs. Evaluation of polyomavirus genomes. Journal of Biological Chemistry, 254(11), 4876-4883.\r\n.. _here: https://opensource.org/licenses/MIT\r\n.. _page: https://github.com/bhagya-ct/molbery/issues\r\n.. _pip: https://pypi.python.org/pypi/pip\r\n.. _joblib: https://pypi.python.org/pypi/joblib\r\n.. _argparse: https://pypi.python.org/pypi/argparse\r\n.. _tabulate: https://pypi.python.org/pypi/tabulate\r\n.. _regex: https://pypi.python.org/pypi/regex\r\n.. _biopython: https://pypi.python.org/pypi/biopython", "description_content_type": null, "docs_url": null, "download_url": "", "downloads": { "last_day": -1, "last_month": -1, "last_week": -1 }, "home_page": "https://github.com/bhagya-ct/molbery", "keywords": "molecular beacons,EATR,CEAM,EXOIII,Target recycling", "license": "MIT", "maintainer": "Manu S", "maintainer_email": "manuvaivasvata7@gmail.com", "name": "molbery", "package_url": "https://pypi.org/project/molbery/", "platform": "ANY", "project_url": "https://pypi.org/project/molbery/", "project_urls": { "Homepage": "https://github.com/bhagya-ct/molbery" }, "release_url": "https://pypi.org/project/molbery/1.0.6/", "requires_dist": null, "requires_python": null, "summary": "A tool for Molecular biologists to design modified Molecular Beacons which works on Exonuclease III Aided Target Recycling strategy for the detection of nucleic acid signatures.", "version": "1.0.6" }, "last_serial": 2493201, "releases": { "1.0": [], "1.0.5": [ { "comment_text": "", "digests": { "md5": "42092d1dea64f1e19eb51240f04aca59", "sha256": "892ff7367987cb30499e6df3d82a45bcd3706a800f5e4097466e874e9cc9d9a1" }, "downloads": -1, "filename": "molbery-1.0.5-py2.py3-none-any.whl", "has_sig": false, "md5_digest": "42092d1dea64f1e19eb51240f04aca59", "packagetype": "bdist_wheel", "python_version": "any", "requires_python": null, "size": 10866, "upload_time": "2016-09-27T14:25:03", "url": "https://files.pythonhosted.org/packages/c5/c1/bee71e167ed1395bed38bbbe45787c8676bf1793651f97477ac9e258c24b/molbery-1.0.5-py2.py3-none-any.whl" }, { "comment_text": "", "digests": { "md5": "8f0a46a8964e81a6e5d3e73ba40b63a0", "sha256": "d2424ea0fba43edaf57da2c9c871eb1d905db9ccdda9196f5ec5971496b08a93" }, "downloads": -1, "filename": "molbery-1.0.5.tar.gz", "has_sig": false, "md5_digest": "8f0a46a8964e81a6e5d3e73ba40b63a0", "packagetype": "sdist", "python_version": "source", "requires_python": null, "size": 7842, "upload_time": "2016-09-27T14:24:49", "url": "https://files.pythonhosted.org/packages/c1/9b/9c3c135f159ed39b1e6b6843021a48e23aeb0943ce53a062a138a6ebaf15/molbery-1.0.5.tar.gz" } ], "1.0.6": [ { "comment_text": "", "digests": { "md5": "677da4010861d61cf3181548e0c80459", "sha256": "6e31306d55705a546d1b4fc269e76a5f2a2ba9f8a1c668e7fa6fb2ad5da4ed50" }, "downloads": -1, "filename": "molbery-1.0.6-py2.py3-none-any.whl", "has_sig": false, "md5_digest": "677da4010861d61cf3181548e0c80459", "packagetype": "bdist_wheel", "python_version": "any", "requires_python": null, "size": 10874, "upload_time": "2016-10-02T09:58:41", "url": "https://files.pythonhosted.org/packages/7a/1e/8dfa71ee89536f64a358b923d7bcd3a1b47ba61dd033cd7d69b5312714db/molbery-1.0.6-py2.py3-none-any.whl" }, { "comment_text": "", "digests": { "md5": "f046bec46e2a41d1b94bdce6b38b6673", "sha256": "c5a4e3998d781f780c2d132f1d3ed5fd9632de5ca6405f02840b1edc8285c22d" }, "downloads": -1, "filename": "molbery-1.0.6.tar.gz", "has_sig": false, "md5_digest": "f046bec46e2a41d1b94bdce6b38b6673", "packagetype": "sdist", "python_version": "source", "requires_python": null, "size": 7840, "upload_time": "2016-10-02T09:58:22", "url": "https://files.pythonhosted.org/packages/e4/68/aaeb84d04107fd1790dfc1d4ee02b591401b4decc7aff82ca39c5e786d6e/molbery-1.0.6.tar.gz" } ] }, "urls": [ { "comment_text": "", "digests": { "md5": "677da4010861d61cf3181548e0c80459", "sha256": "6e31306d55705a546d1b4fc269e76a5f2a2ba9f8a1c668e7fa6fb2ad5da4ed50" }, "downloads": -1, "filename": "molbery-1.0.6-py2.py3-none-any.whl", "has_sig": false, "md5_digest": "677da4010861d61cf3181548e0c80459", "packagetype": "bdist_wheel", "python_version": "any", "requires_python": null, "size": 10874, "upload_time": "2016-10-02T09:58:41", "url": "https://files.pythonhosted.org/packages/7a/1e/8dfa71ee89536f64a358b923d7bcd3a1b47ba61dd033cd7d69b5312714db/molbery-1.0.6-py2.py3-none-any.whl" }, { "comment_text": "", "digests": { "md5": "f046bec46e2a41d1b94bdce6b38b6673", "sha256": "c5a4e3998d781f780c2d132f1d3ed5fd9632de5ca6405f02840b1edc8285c22d" }, "downloads": -1, "filename": "molbery-1.0.6.tar.gz", "has_sig": false, "md5_digest": "f046bec46e2a41d1b94bdce6b38b6673", "packagetype": "sdist", "python_version": "source", "requires_python": null, "size": 7840, "upload_time": "2016-10-02T09:58:22", "url": "https://files.pythonhosted.org/packages/e4/68/aaeb84d04107fd1790dfc1d4ee02b591401b4decc7aff82ca39c5e786d6e/molbery-1.0.6.tar.gz" } ] }