{ "info": { "author": "Kale Kundert", "author_email": "kale.kundert@ucsf.edu", "bugtrack_url": null, "classifiers": [ "Intended Audience :: Science/Research", "Programming Language :: Python :: 2", "Topic :: Scientific/Engineering :: Bio-Informatics" ], "description": "``kbkdna`` --- Simple tools for working with DNA\n================================================\nWhen doing biology, sometimes you just need to quickly know how long a \nDNA sequence is, or what its reverse complement is. There are lots of \ntools out there that can tell you these things, but they often do a \nlot more than that too and can be overkill for really quick questions. \nIn contrast, this package provides an easy-to-use command-line app \nthat's just designed to give simple answers to simple questions.\n\n.. image:: https://img.shields.io/pypi/v/kbkdna.svg\n :target: https://pypi.python.org/pypi/kbkdna\n.. image:: https://img.shields.io/pypi/pyversions/kbkdna.svg\n :target: https://pypi.python.org/pypi/kbkdna\n.. image:: https://img.shields.io/travis/kalekundert/kbkdna.svg\n :target: https://travis-ci.org/kalekundert/kbkdna\n.. image:: https://readthedocs.org/projects/kbkdna/badge/?version=latest\n :target: http://kbkdna.readthedocs.io/en/latest/\n\nInstallation\n------------\nYou can install ``kbkdna`` from PyPI using ``pip``::\n\n $ pip install kbkdna\n\nUsage\n-----\nThe command-line application that gets installed is called ``dna``. \nYou can use the ``--help`` flag to get information on the kinds of \nthings it can calculate::\n\n $ dna --help\n\nYou can use the ``len`` command to get the length of a DNA sequence::\n\n $ dna len CATCTAATTCAACAAGAATT\n 20\n\nYou can use the ``rc`` command to get the reverse complement of a DNA \nsequence::\n\n $ dna rc CATCTAATTCAACAAGAATT\n AATTCTTGTTGAATTAGATG\n\nYou can use the ``gc`` command to calculate the GC content of a DNA \nsequence::\n\n $ dna gc CATCTAATTCAACAAGAATT\n 25.0%", "description_content_type": null, "docs_url": null, "download_url": "UNKNOWN", "downloads": { "last_day": -1, "last_month": -1, "last_week": -1 }, "home_page": "http://github.com/kalekundert/kbkdna", "keywords": null, "license": "UNKNOWN", "maintainer": null, "maintainer_email": null, "name": "kbkdna", "package_url": "https://pypi.org/project/kbkdna/", "platform": "UNKNOWN", "project_url": "https://pypi.org/project/kbkdna/", "project_urls": { "Download": "UNKNOWN", "Homepage": "http://github.com/kalekundert/kbkdna" }, "release_url": "https://pypi.org/project/kbkdna/0.0.0/", "requires_dist": null, "requires_python": null, "summary": "Simple tools for working with DNA", "version": "0.0.0" }, "last_serial": 2503344, "releases": { "0.0.0": [ { "comment_text": "", "digests": { "md5": "0367ebd7323f76eb2ea7696f954412b6", "sha256": "643d752d513259eb91d7ee4237178e4c04912e7adec76ff6707f39aa875df05f" }, "downloads": -1, "filename": "kbkdna-0.0.0.tar.gz", "has_sig": false, "md5_digest": "0367ebd7323f76eb2ea7696f954412b6", "packagetype": "sdist", "python_version": "source", "requires_python": null, "size": 1866, "upload_time": "2016-12-06T19:41:16", "url": "https://files.pythonhosted.org/packages/bf/67/a434b4649c18f0d9e67581dd5878b24763c73d969c2eb9c8f025b2daeb14/kbkdna-0.0.0.tar.gz" } ] }, "urls": [ { "comment_text": "", "digests": { "md5": "0367ebd7323f76eb2ea7696f954412b6", "sha256": "643d752d513259eb91d7ee4237178e4c04912e7adec76ff6707f39aa875df05f" }, "downloads": -1, "filename": "kbkdna-0.0.0.tar.gz", "has_sig": false, "md5_digest": "0367ebd7323f76eb2ea7696f954412b6", "packagetype": "sdist", "python_version": "source", "requires_python": null, "size": 1866, "upload_time": "2016-12-06T19:41:16", "url": "https://files.pythonhosted.org/packages/bf/67/a434b4649c18f0d9e67581dd5878b24763c73d969c2eb9c8f025b2daeb14/kbkdna-0.0.0.tar.gz" } ] }